Cherry SNP DataBase

SNP information

Name Pav_sc0000200.1_40885M
Chr PAV_r1.0chr2
Pos (Chr) 12611671
PAV_r1.0 Pav_sc0000200.1
Pos (PAV_r1.0) 40885
REF C
ALT A
SSR motif
Gene Name Pav_sc0000200.1_g050.1.mk
Annotation PREDICTED: nucleoside diphosphate kinase 1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.51+127C>A
Amino Acid
PCR Forward primer ACGGAAAACATGGAGCAAAC
Reverse primer AAACCAACCCCTTCAATTCC
Product size 273
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |