Cherry SNP DataBase

SNP information

Name Pav_sc0000200.1_57204R
Chr PAV_r1.0chr2
Pos (Chr) 12595352
PAV_r1.0 Pav_sc0000200.1
Pos (PAV_r1.0) 57204
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.57204G>A
Amino Acid
PCR Forward primer CTTGCAATGGTGTGTTCATTG
Reverse primer TTGGTCCATCCCACCTTTTA
Product size 331
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |