Cherry SNP DataBase

SNP information

Name Pav_sc0000201.1_16980W
Chr PAV_r1.0chr8
Pos (Chr) 3568335
PAV_r1.0 Pav_sc0000201.1
Pos (PAV_r1.0) 16980
REF A
ALT T
SSR motif
Gene Name Pav_sc0000201.1_g040.1.br
Annotation PREDICTED: F-box/LRR-repeat protein At3g58900-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.246+280A>T
Amino Acid
PCR Forward primer GCGCAGTGCGTAAGTATTCA
Reverse primer CATTCATATGCAGAAGGCCC
Product size 267
Enzymes for CAPS AluI | HindIII
Exp. fragment size (REF) 212,27,28 | 237,30
Exp. fragment size (ALT) 195,17,27,28 | 193,44,30
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |