Cherry SNP DataBase

SNP information

Name Pav_sc0000203.1_73703S
Chr PAV_r1.0chr6
Pos (Chr) 16699016
PAV_r1.0 Pav_sc0000203.1
Pos (PAV_r1.0) 73703
REF C
ALT G
SSR motif
Gene Name Pav_sc0000203.1_g170.1.mk
Annotation PREDICTED: MLO-like protein 3
snpEff Effect intron_variant
Impact MODIFIER
Codon c.566-59G>C
Amino Acid
PCR Forward primer TGAAGCCATGTCTCAAGGTG
Reverse primer AGGCAAACAACAGGTGGAAG
Product size 240
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |