Cherry SNP DataBase

SNP information

Name Pav_sc0000207.1_25317R
Chr PAV_r1.0chr1
Pos (Chr) 3348584
PAV_r1.0 Pav_sc0000207.1
Pos (PAV_r1.0) 25317
REF A
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.25317A>G
Amino Acid
PCR Forward primer TTTGGGAAACATTCCATTTGA
Reverse primer TTTGAACCAACATTGCGTCT
Product size 326
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT


| Top |