Cherry SNP DataBase

SNP information

Name Pav_sc0000216.1_491647M
Chr PAV_r1.0chr6
Pos (Chr) 10332527
PAV_r1.0 Pav_sc0000216.1
Pos (PAV_r1.0) 491647
REF A
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.491647A>C
Amino Acid
PCR Forward primer TGCACCAGGGTTTAGGGTAG
Reverse primer CAAGAGTAGGCACACTGGCA
Product size 311
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |