Cherry SNP DataBase

SNP information

Name Pav_sc0000289.1_29493Y
Chr PAV_r1.0chr4
Pos (Chr) 23073694
PAV_r1.0 Pav_sc0000289.1
Pos (PAV_r1.0) 29493
REF T
ALT C
SSR motif
Gene Name Pav_sc0000289.1_g040.1.br
Annotation PREDICTED: ankyrin repeat-containing protein At3g12360-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.523+297A>G
Amino Acid
PCR Forward primer GTTTCTTGTGCCCTTTGCAT
Reverse primer ATTCAACAACCACACCAGCA
Product size 291
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |