Cherry SNP DataBase

SNP information

Name Pav_sc0000291.1_16097K
Chr PAV_r1.0chr5
Pos (Chr) 2301125
PAV_r1.0 Pav_sc0000291.1
Pos (PAV_r1.0) 16097
REF G
ALT T
SSR motif
Gene Name Pav_sc0000291.1_g040.1.mk
Annotation PREDICTED: MOB kinase activator-like 1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.287+96C>A
Amino Acid
PCR Forward primer TTGCAGCAAACTGAATCCAT
Reverse primer GGCCCCAAGTATGGGATTAT
Product size 251
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/REF REF/ALT ALT/ALT ALT/ALT REF/REF


| Top |