Cherry SNP DataBase

SNP information

Name Pav_sc0000292.1_16320W
Chr PAV_r1.0chr6
Pos (Chr) 15971212
PAV_r1.0 Pav_sc0000292.1
Pos (PAV_r1.0) 16320
REF A
ALT T
SSR motif
Gene Name Pav_sc0000292.1_g050.1.mk
Annotation PREDICTED: probable receptor-like protein kinase At5g24010
snpEff Effect missense_variant
Impact MODERATE
Codon c.792T>A
Amino Acid p.Asp264Glu
PCR Forward primer TGTTGAAGGGATTGGGTAGC
Reverse primer AATGCCATTGAAGTCTTCCG
Product size 331
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |