Cherry SNP DataBase

SNP information

Name Pav_sc0000293.1_336825R
Chr PAV_r1.0chr3
Pos (Chr) 747637
PAV_r1.0 Pav_sc0000293.1
Pos (PAV_r1.0) 336825
REF A
ALT G
SSR motif
Gene Name Pav_sc0000293.1_g560.1.mk
Annotation PREDICTED: E3 ubiquitin-protein ligase MARCH2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.-89+385T>C
Amino Acid
PCR Forward primer TTTCAAGTTCAACACCCAACC
Reverse primer TGTCATGGCCAAACTGAGAA
Product size 325
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/ALT


| Top |