Cherry SNP DataBase

SNP information

Name Pav_sc0000299.1_109884Y
Chr PAV_r1.0chr3
Pos (Chr) 19760663
PAV_r1.0 Pav_sc0000299.1
Pos (PAV_r1.0) 109884
REF T
ALT C
SSR motif
Gene Name Pav_sc0000299.1_g230.1.mk
Annotation H(+)-transporting atpase plant/fungi plasma membrane type, putative
snpEff Effect intron_variant
Impact MODIFIER
Codon c.462+11A>G
Amino Acid
PCR Forward primer ACAGAAATTCCCAATGGCAG
Reverse primer TGCACTTACAGGCGAGTCAC
Product size 304
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |