Cherry SNP DataBase

SNP information

Name Pav_sc0000304.1_91379M
Chr PAV_r1.0chr2
Pos (Chr) 840289
PAV_r1.0 Pav_sc0000304.1
Pos (PAV_r1.0) 91379
REF A
ALT C
SSR motif
Gene Name Pav_sc0000304.1_g090.1.mk
Annotation PREDICTED: pentatricopeptide repeat-containing protein At3g61360-like isoform X1
snpEff Effect missense_variant
Impact MODERATE
Codon c.665A>C
Amino Acid p.Tyr222Ser
PCR Forward primer TCCAGCCAATTTCTACCGTC
Reverse primer TTTTCCATCAAGTCCCAAGC
Product size 323
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |