Cherry SNP DataBase

SNP information

Name Pav_sc0000304.1_91380M
Chr PAV_r1.0chr2
Pos (Chr) 840288
PAV_r1.0 Pav_sc0000304.1
Pos (PAV_r1.0) 91380
REF C
ALT A
SSR motif
Gene Name Pav_sc0000304.1_g090.1.mk
Annotation PREDICTED: pentatricopeptide repeat-containing protein At3g61360-like isoform X1
snpEff Effect stop_gained
Impact HIGH
Codon c.666C>A
Amino Acid p.Tyr222*
PCR Forward primer TCCAGCCAATTTCTACCGTC
Reverse primer TTTTCCATCAAGTCCCAAGC
Product size 323
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |