Cherry SNP DataBase

SNP information

Name Pav_sc0000323.1_372954Y
Chr PAV_r1.0chr6
Pos (Chr) 5967164
PAV_r1.0 Pav_sc0000323.1
Pos (PAV_r1.0) 372954
REF T
ALT C
SSR motif
Gene Name Pav_sc0000323.1_g760.1.mk
Annotation PREDICTED: vacuolar proton ATPase a1-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.-1841+294A>G
Amino Acid
PCR Forward primer TTATGCCCCTTCAACTTTGG
Reverse primer GGTGTCTGGATTTGCTCCAT
Product size 258
Enzymes for CAPS HhaI
Exp. fragment size (REF) 258
Exp. fragment size (ALT) 176,82
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |