Cherry SNP DataBase

SNP information

Name Pav_sc0000348.1_253112S
Chr PAV_r1.0chr7
Pos (Chr) 12600990
PAV_r1.0 Pav_sc0000348.1
Pos (PAV_r1.0) 253112
REF G
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.253112G>C
Amino Acid
PCR Forward primer CTATGATTTGGATGGTGGGG
Reverse primer TGCTGTACGTAGCCCAGACA
Product size 338
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |