Cherry SNP DataBase

SNP information

Name Pav_sc0000349.1_67144Y
Chr PAV_r1.0chr6
Pos (Chr) 15676485
PAV_r1.0 Pav_sc0000349.1
Pos (PAV_r1.0) 67144
REF C
ALT T
SSR motif
Gene Name Pav_sc0000349.1_g110.1.mk
Annotation PREDICTED: molybdate-anion transporter isoform X1
snpEff Effect 5_prime_UTR_variant
Impact MODIFIER
Codon c.-170C>T
Amino Acid
PCR Forward primer ACGTTTGGATTGTCCGCTAC
Reverse primer AGCTTCGGATCTCAGGGATT
Product size 230
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF


| Top |