Cherry SNP DataBase

SNP information

Name Pav_sc0000358.1_417924Y
Chr PAV_r1.0chr5
Pos (Chr) 15198838
PAV_r1.0 Pav_sc0000358.1
Pos (PAV_r1.0) 417924
REF T
ALT C
SSR motif
Gene Name Pav_sc0000358.1_g910.1.mk
Annotation PREDICTED: phosphatidylinositol 4-kinase gamma 7-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.45+1138T>C
Amino Acid
PCR Forward primer TCAACGGCGGTTCTAATTTT
Reverse primer ACATTTGCCGCTTGTTTACC
Product size 220
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT ALT/ALT ALT/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT


| Top |