Cherry SNP DataBase

SNP information

Name Pav_sc0000372.1_23826Y
Chr PAV_r1.0chr6
Pos (Chr) 10134879
PAV_r1.0 Pav_sc0000372.1
Pos (PAV_r1.0) 23826
REF T
ALT C
SSR motif
Gene Name Pav_sc0000372.1_g070.1.mk
Annotation PREDICTED: uncharacterized protein LOC103327070 isoform X1
snpEff Effect missense_variant
Impact MODERATE
Codon c.1055T>C
Amino Acid p.Met352Thr
PCR Forward primer GTCAAATGATGGCGGAAAAG
Reverse primer GATTCATCCGATCTCGCAGT
Product size 320
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT ALT/ALT REF/REF


| Top |