Cherry SNP DataBase

SNP information

Name Pav_sc0000372.1_24290R
Chr PAV_r1.0chr6
Pos (Chr) 10134415
PAV_r1.0 Pav_sc0000372.1
Pos (PAV_r1.0) 24290
REF A
ALT G
SSR motif
Gene Name Pav_sc0000372.1_g070.1.mk
Annotation PREDICTED: uncharacterized protein LOC103327070 isoform X1
snpEff Effect synonymous_variant
Impact LOW
Codon c.1434A>G
Amino Acid p.Pro478Pro
PCR Forward primer TGTAGCGCTATTGCCTCAGA
Reverse primer TTCATCACACTCCATCTCGC
Product size 345
Enzymes for CAPS MspI
Exp. fragment size (REF) 345
Exp. fragment size (ALT) 194,151
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/ALT ALT/ALT REF/REF


| Top |