Cherry SNP DataBase

SNP information

Name Pav_sc0000372.1_27309R
Chr PAV_r1.0chr6
Pos (Chr) 10131396
PAV_r1.0 Pav_sc0000372.1
Pos (PAV_r1.0) 27309
REF G
ALT A
SSR motif
Gene Name Pav_sc0000372.1_g070.1.mk
Annotation PREDICTED: uncharacterized protein LOC103327070 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1783-84G>A
Amino Acid
PCR Forward primer TAGATTCCTGGTCCACTGCC
Reverse primer TGGCGCTGTGATATAAGCTG
Product size 284
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |