Cherry SNP DataBase

SNP information

Name Pav_sc0000373.1_104007Y
Chr PAV_r1.0chr8
Pos (Chr) 13891059
PAV_r1.0 Pav_sc0000373.1
Pos (PAV_r1.0) 104007
REF T
ALT C
SSR motif
Gene Name Pav_sc0000373.1_g230.1.mk
Annotation PREDICTED: thaumatin-like protein 1b
snpEff Effect intron_variant
Impact MODIFIER
Codon c.755+146T>C
Amino Acid
PCR Forward primer GCGCCTCTGCAGACTACATT
Reverse primer ATGGCCCTCACATTCATAGC
Product size 290
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |