Cherry SNP DataBase

SNP information

Name Pav_sc0000375.1_188922Y
Chr PAV_r1.0chr6
Pos (Chr) 1694577
PAV_r1.0 Pav_sc0000375.1
Pos (PAV_r1.0) 188922
REF T
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.188922T>C
Amino Acid
PCR Forward primer CATTGGGAAAAACCTCATGG
Reverse primer TGGGCGAGTTCAAGTTTTCT
Product size 347
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |