Cherry SNP DataBase

SNP information

Name Pav_sc0000376.1_499994Y
Chr PAV_r1.0chr4
Pos (Chr) 21855916
PAV_r1.0 Pav_sc0000376.1
Pos (PAV_r1.0) 499994
REF C
ALT T
SSR motif
Gene Name Pav_sc0000376.1_g800.1.mk
Annotation cinnamoyl-CoA reductase 1
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*404C>T
Amino Acid
PCR Forward primer TCCAAGGAGAAGGCAAAGAA
Reverse primer GCATGAACACACTTGACTCTCAG
Product size 295
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/REF REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |