Cherry SNP DataBase

SNP information

Name Pav_sc0000379.1_60999K
Chr PAV_r1.0chr8
Pos (Chr) 1297964
PAV_r1.0 Pav_sc0000379.1
Pos (PAV_r1.0) 60999
REF G
ALT T
SSR motif
Gene Name Pav_sc0000379.1_g080.1.mk
Annotation PREDICTED: DEAD-box ATP-dependent RNA helicase 47A
snpEff Effect synonymous_variant
Impact LOW
Codon c.1506C>A
Amino Acid p.Gly502Gly
PCR Forward primer GCAATTGGAACGCTAAGCTG
Reverse primer CGTGGAATGATAGCAGCAGA
Product size 305
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/REF REF/REF ALT/ALT REF/REF


| Top |