Cherry SNP DataBase

SNP information

Name Pav_sc0000383.1_270407K
Chr PAV_r1.0chr5
Pos (Chr) 15657050
PAV_r1.0 Pav_sc0000383.1
Pos (PAV_r1.0) 270407
REF G
ALT T
SSR motif
Gene Name Pav_sc0000383.1_g540.1.mk
Annotation PREDICTED: coatomer subunit alpha-1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.829-492G>T
Amino Acid
PCR Forward primer CCCTACGATCCTGACCCATA
Reverse primer CATTCGGTGGGATTTGTACC
Product size 334
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |