Cherry SNP DataBase

SNP information

Name Pav_sc0000383.1_493485S
Chr PAV_r1.0chr5
Pos (Chr) 15433972
PAV_r1.0 Pav_sc0000383.1
Pos (PAV_r1.0) 493485
REF C
ALT G
SSR motif
Gene Name Pav_sc0000383.1_g980.1.mk
Annotation PREDICTED: protein CHUP1, chloroplastic-like
snpEff Effect missense_variant
Impact MODERATE
Codon c.872G>C
Amino Acid p.Arg291Pro
PCR Forward primer GAGGAGCTGTCAATGGTGGT
Reverse primer GCAGGTTGAGGCATACCAAT
Product size 271
Enzymes for CAPS HhaI
Exp. fragment size (REF) 179,92
Exp. fragment size (ALT) 271
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |