Cherry SNP DataBase

SNP information

Name Pav_sc0000383.1_496572S
Chr PAV_r1.0chr5
Pos (Chr) 15430885
PAV_r1.0 Pav_sc0000383.1
Pos (PAV_r1.0) 496572
REF G
ALT C
SSR motif
Gene Name Pav_sc0000383.1_g990.1.mk
Annotation PREDICTED: translation initiation factor eIF-2B subunit delta
snpEff Effect intron_variant
Impact MODIFIER
Codon c.608-38G>C
Amino Acid
PCR Forward primer TAATTGCGTTGAGGCGTGTA
Reverse primer CCTTCTTGTCAGAAGCAGCC
Product size 326
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |