Cherry SNP DataBase

SNP information

Name Pav_sc0000383.1_581407W
Chr PAV_r1.0chr5
Pos (Chr) 15346050
PAV_r1.0 Pav_sc0000383.1
Pos (PAV_r1.0) 581407
REF T
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.581407T>A
Amino Acid
PCR Forward primer TGTTTCCTAGGGTTTGGCAG
Reverse primer ACACCTCATTGCCTTTGGAC
Product size 217
Enzymes for CAPS AfaI
Exp. fragment size (REF) 217
Exp. fragment size (ALT) 71,146
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |