Cherry SNP DataBase

SNP information

Name Pav_sc0000396.1_253783W
Chr PAV_r1.0chr6
Pos (Chr) 23544595
PAV_r1.0 Pav_sc0000396.1
Pos (PAV_r1.0) 253783
REF T
ALT A
SSR motif
Gene Name Pav_sc0000396.1_g520.1.mk
Annotation PREDICTED: cell division cycle 5-like protein
snpEff Effect intron_variant
Impact MODIFIER
Codon c.786+296A>T
Amino Acid
PCR Forward primer CATTTGGCATGTCCTTTGAA
Reverse primer TTGTAAATCGGAGAGACGGG
Product size 339
Enzymes for CAPS DraI
Exp. fragment size (REF) 256,83
Exp. fragment size (ALT) 255,84
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |