Cherry SNP DataBase

SNP information

Name Pav_sc0000396.1_458526R
Chr PAV_r1.0chr6
Pos (Chr) 23339852
PAV_r1.0 Pav_sc0000396.1
Pos (PAV_r1.0) 458526
REF A
ALT G
SSR motif
Gene Name Pav_sc0000396.1_g1010.1.mk
Annotation PREDICTED: receptor-like protein kinase ANXUR1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1525+119T>C
Amino Acid
PCR Forward primer CCTTGTACAGATGCTCCCGT
Reverse primer TAGCAGCCACCTCACAACAG
Product size 344
Enzymes for CAPS HaeIII
Exp. fragment size (REF) 314,30
Exp. fragment size (ALT) 186,128,30
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT ALT/ALT ALT/ALT ALT/ALT ALT/ALT REF/ALT REF/ALT


| Top |