Cherry SNP DataBase

SNP information

Name Pav_sc0000396.1_523876M
Chr PAV_r1.0chr6
Pos (Chr) 23274502
PAV_r1.0 Pav_sc0000396.1
Pos (PAV_r1.0) 523876
REF C
ALT A
SSR motif
Gene Name Pav_sc0000396.1_g1130.1.mk
Annotation PREDICTED: transcription factor UNE12-like isoform X2
snpEff Effect synonymous_variant
Impact LOW
Codon c.105G>T
Amino Acid p.Gly35Gly
PCR Forward primer AGCAGCAGCTGAAGAAGACC
Reverse primer TCTCTCTCAGGGGCTCAAGA
Product size 326
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/REF


| Top |