Cherry SNP DataBase

SNP information

Name Pav_sc0000396.1_556077R
Chr PAV_r1.0chr6
Pos (Chr) 23242301
PAV_r1.0 Pav_sc0000396.1
Pos (PAV_r1.0) 556077
REF A
ALT G
SSR motif
Gene Name Pav_sc0000396.1_g1220.1.mk
Annotation PREDICTED: uncharacterized protein LOC103318633
snpEff Effect synonymous_variant
Impact LOW
Codon c.570T>C
Amino Acid p.Asn190Asn
PCR Forward primer ATCCATGGACCCAAGAAGGT
Reverse primer TGAGGATGATTTTGCAATGCT
Product size 347
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT


| Top |