Cherry SNP DataBase

SNP information

Name Pav_sc0000410.1_342790R
Chr PAV_r1.0chr1
Pos (Chr) 26927676
PAV_r1.0 Pav_sc0000410.1
Pos (PAV_r1.0) 342790
REF G
ALT A
SSR motif
Gene Name Pav_sc0000410.1_g500.1.mk
Annotation PREDICTED: nucleolin 2 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.573+75G>A
Amino Acid
PCR Forward primer CGCTCCAAAGAAGAAGGATG
Reverse primer TGAAGCGTTAATGCTCATGC
Product size 254
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |