Cherry SNP DataBase

SNP information

Name Pav_sc0000412.1_91151W
Chr PAV_r1.0chr8
Pos (Chr) 15419135
PAV_r1.0 Pav_sc0000412.1
Pos (PAV_r1.0) 91151
REF T
ALT A
SSR motif
Gene Name Pav_sc0000412.1_g210.1.mk
Annotation PREDICTED: uncharacterized protein LOC103334625
snpEff Effect intron_variant
Impact MODIFIER
Codon c.880-130T>A
Amino Acid
PCR Forward primer TTGTGATTTTTCTTGCTGCG
Reverse primer TTAGCGAACACCACAACTGC
Product size 332
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT REF/ALT


| Top |