Cherry SNP DataBase

SNP information

Name Pav_sc0000422.1_59505Y
Chr PAV_r1.0chr2
Pos (Chr) 9600624
PAV_r1.0 Pav_sc0000422.1
Pos (PAV_r1.0) 59505
REF T
ALT C
SSR motif
Gene Name Pav_sc0000422.1_g080.1.mk
Annotation hypothetical protein PRUPE_ppa000047mg
snpEff Effect intron_variant
Impact MODIFIER
Codon c.259-172A>G
Amino Acid
PCR Forward primer ACATGCGATGGTGAATACGA
Reverse primer TTCTGGGGTGATTTCTGGTC
Product size 338
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |