Cherry SNP DataBase

SNP information

Name Pav_sc0000465.1_619673K
Chr PAV_r1.0chr4
Pos (Chr) 21725475
PAV_r1.0 Pav_sc0000465.1
Pos (PAV_r1.0) 619673
REF T
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.619673T>G
Amino Acid
PCR Forward primer TAAGGCTCTGCATTTCTCGC
Reverse primer TGACATTTTTCCGACTGCAA
Product size 253
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT ALT/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |