Cherry SNP DataBase

SNP information

Name Pav_sc0000474.1_186447R
Chr PAV_r1.0chr5
Pos (Chr) 1372810
PAV_r1.0 Pav_sc0000474.1
Pos (PAV_r1.0) 186447
REF A
ALT G
SSR motif
Gene Name Pav_sc0000474.1_g340.1.mk
Annotation PREDICTED: alkylated DNA repair protein alkB homolog 8
snpEff Effect intron_variant
Impact MODIFIER
Codon c.982-571A>G
Amino Acid
PCR Forward primer GCTCTGGTGATGCCTTTTTC
Reverse primer GAAGACAGAAAGGGCTTGGA
Product size 318
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/ALT REF/REF ALT/ALT REF/REF


| Top |