Cherry SNP DataBase

SNP information

Name Pav_sc0000480.1_653393Y
Chr PAV_r1.0chr6
Pos (Chr) 7649214
PAV_r1.0 Pav_sc0000480.1
Pos (PAV_r1.0) 653393
REF C
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.653393C>T
Amino Acid
PCR Forward primer TTCTTCCTCCACCCTCCTTT
Reverse primer CAATGTGTCATGCCCGTAAG
Product size 333
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/REF REF/ALT REF/REF REF/REF


| Top |