Cherry SNP DataBase

SNP information

Name Pav_sc0000481.1_161030M
Chr PAV_r1.0chr4
Pos (Chr) 5485737
PAV_r1.0 Pav_sc0000481.1
Pos (PAV_r1.0) 161030
REF C
ALT A
SSR motif
Gene Name Pav_sc0000481.1_g220.1.mk
Annotation PREDICTED: ABC transporter C family member 2-like
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*4780G>T
Amino Acid
PCR Forward primer CTGACCACCACCCTTGTCTT
Reverse primer TCGTTAGGGACCGAACTGAG
Product size 276
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT ALT/ALT REF/ALT REF/REF REF/ALT


| Top |