Cherry SNP DataBase

SNP information

Name Pav_sc0000481.1_42307M
Chr PAV_r1.0chr4
Pos (Chr) 5604460
PAV_r1.0 Pav_sc0000481.1
Pos (PAV_r1.0) 42307
REF C
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.42307C>A
Amino Acid
PCR Forward primer CCAACGGCTCAGATCTCTTC
Reverse primer TTCTCATAATTTGGTCGGGC
Product size 315
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/REF REF/ALT REF/ALT REF/ALT


| Top |