Cherry SNP DataBase

SNP information

Name Pav_sc0000488.1_175233S
Chr PAV_r1.0chr3
Pos (Chr) 14373459
PAV_r1.0 Pav_sc0000488.1
Pos (PAV_r1.0) 175233
REF G
ALT C
SSR motif
Gene Name Pav_sc0000488.1_g390.1.br
Annotation PREDICTED: uncharacterized protein At4g26485-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.355-130C>G
Amino Acid
PCR Forward primer AAATCAATTAGCCCCCAAGG
Reverse primer TTGGAAAATCATCAACATCCAG
Product size 332
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |