Cherry SNP DataBase

SNP information

Name Pav_sc0000488.1_295624K
Chr PAV_r1.0chr3
Pos (Chr) 14253068
PAV_r1.0 Pav_sc0000488.1
Pos (PAV_r1.0) 295624
REF T
ALT G
SSR motif
Gene Name Pav_sc0000488.1_g640.1.mk
Annotation PREDICTED: endoplasmic reticulum-Golgi intermediate compartment protein 3
snpEff Effect intron_variant
Impact MODIFIER
Codon c.607-235A>C
Amino Acid
PCR Forward primer TGCAGAAAAATGGCAGTTGA
Reverse primer AAATTGGTTTTTGGCGTTTG
Product size 240
Enzymes for CAPS MboI
Exp. fragment size (REF) 29,211
Exp. fragment size (ALT) 29,125,86
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF REF/REF


| Top |