Cherry SNP DataBase

SNP information

Name Pav_sc0000488.1_30445K
Chr PAV_r1.0chr3
Pos (Chr) 14518247
PAV_r1.0 Pav_sc0000488.1
Pos (PAV_r1.0) 30445
REF T
ALT G
SSR motif
Gene Name Pav_sc0000488.1_g060.1.mk
Annotation PREDICTED: ribonuclease E/G-like protein, chloroplastic isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.161+267A>C
Amino Acid
PCR Forward primer TTTGGCAAGCCCATATTCAT
Reverse primer CTGCAGACCCAAGTCGTGTA
Product size 214
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT -/- REF/REF REF/ALT REF/ALT REF/ALT


| Top |