Cherry SNP DataBase

SNP information

Name Pav_sc0000499.1_72067M
Chr PAV_r1.0chr6
Pos (Chr) 12538484
PAV_r1.0 Pav_sc0000499.1
Pos (PAV_r1.0) 72067
REF A
ALT C
SSR motif
Gene Name Pav_sc0000499.1_g120.1.mk
Annotation PREDICTED: beta-glucosidase 11-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.479+20T>G
Amino Acid
PCR Forward primer ACCAAATGGAGCTGAACACC
Reverse primer CACCACAGTGATCTCCCACA
Product size 301
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |