Cherry SNP DataBase

SNP information

Name Pav_sc0000501.1_41967R
Chr PAV_r1.0chr2
Pos (Chr) 3470990
PAV_r1.0 Pav_sc0000501.1
Pos (PAV_r1.0) 41967
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.41967G>A
Amino Acid
PCR Forward primer CAGATTCCCAACGCCACTAT
Reverse primer TGTGCTCTCAAGGACATTGG
Product size 279
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |