Cherry SNP DataBase

SNP information

Name Pav_sc0000501.1_42009K
Chr PAV_r1.0chr2
Pos (Chr) 3471032
PAV_r1.0 Pav_sc0000501.1
Pos (PAV_r1.0) 42009
REF G
ALT T
SSR motif
Gene Name Pav_sc0000501.1_g140.1.mk
Annotation initiation factor 5a, putative
snpEff Effect missense_variant
Impact MODERATE
Codon c.239C>A
Amino Acid p.Thr80Asn
PCR Forward primer GTCCTCGCCTTCCAATTACA
Reverse primer ACACCAAGGACGATTTGAGG
Product size 305
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |