Cherry SNP DataBase

SNP information

Name Pav_sc0000501.1_44264Y
Chr PAV_r1.0chr2
Pos (Chr) 3473287
PAV_r1.0 Pav_sc0000501.1
Pos (PAV_r1.0) 44264
REF T
ALT C
SSR motif
Gene Name Pav_sc0000501.1_g150.1.br
Annotation PREDICTED: putative disease resistance RPP13-like protein 1
snpEff Effect missense_variant
Impact MODERATE
Codon c.1267T>C
Amino Acid p.Trp423Arg
PCR Forward primer AAACATGCCTTCGAAAATGG
Reverse primer AAACTTTCTGCCACCCACAG
Product size 335
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |