Cherry SNP DataBase

SNP information

Name Pav_sc0000503.1_109734R
Chr PAV_r1.0chr2
Pos (Chr) 11021037
PAV_r1.0 Pav_sc0000503.1
Pos (PAV_r1.0) 109734
REF A
ALT G
SSR motif
Gene Name Pav_sc0000503.1_g160.1.mk
Annotation PREDICTED: glycine-rich protein A3-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.462T>C
Amino Acid p.His154His
PCR Forward primer TCCATTTCTTGAACTTGCCC
Reverse primer TATGGGAGGGATGCTAGCTG
Product size 209
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/ALT REF/ALT REF/REF


| Top |