Cherry SNP DataBase

SNP information

Name Pav_sc0000503.1_413881S
Chr PAV_r1.0chr2
Pos (Chr) 11325184
PAV_r1.0 Pav_sc0000503.1
Pos (PAV_r1.0) 413881
REF G
ALT C
SSR motif
Gene Name Pav_sc0000503.1_g810.1.mk
Annotation PREDICTED: ent-kaurenoic acid oxidase 1-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1466+35C>G
Amino Acid
PCR Forward primer AAGTACATCAATGGGCCGTC
Reverse primer CCCTGCTGGCTCAGAACTAC
Product size 294
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |