Cherry SNP DataBase

SNP information

Name Pav_sc0000503.1_81560R
Chr PAV_r1.0chr2
Pos (Chr) 10992863
PAV_r1.0 Pav_sc0000503.1
Pos (PAV_r1.0) 81560
REF G
ALT A
SSR motif
Gene Name Pav_sc0000503.1_g140.1.mk
Annotation PREDICTED: uncharacterized protein LOC103331357
snpEff Effect intron_variant
Impact MODIFIER
Codon c.-143-817C>T
Amino Acid
PCR Forward primer CAATTCATTGATTGAGACCACC
Reverse primer AAGTTGGGTTCTTTCTTGCG
Product size 336
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |